N. benthi small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TCTGAACAATCACAACTGCAA
Length: 21 nucleotides
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
19w98,403,594Phasing windowNbL09g16070c98,403,12498,405,901Nicotiana tabacum ankyrin repeat-containing protein At5g02620-like (LOC107804847), mRNA (XM_016628784.1,XP_016484270.1)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
211c22,726,911Phasing windowNbL11g03030w22,724,53622,727,913Nicotiana tabacum ankyrin repeat-containing protein At5g02620-like (LOC107804847), mRNA (XM_016628784.1,XP_016484270.1)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  10M
25Bm_Sat0900,692  0
Nben_Flr_a06,835,485  0
Nben_Flr_b014,515,135  0
Nben_Stem_a02,237,218  0
Nben_Stem_b111,459,664  1
Nben_Root_a03,382,498  0
Nben_Root_b04,855,847  0
Nben_Leaf_a03,450,574  0
Nben_Leaf_b02,865,988  0
Nben_Seedling_a03,370,346  0
Nben_Seedling_b08,891,749  0
NBen_LeafBTI02,124,862  0
25Bm01,875,367  0
25Mock015,007,443  0
18Bm_Sat01,141,536  0
18Bm01,387,039  0
18Mock015,274,479  0
cym19s_i03,557,416  0
cym19s_ip0450,931  0
mock_i017,329,512  0
mock_ip09,921,543  0
rsv_i101,441,228  0
rsv_ip0380,044  0
cym19_1ip02,155,301  0
cym19_2ip0741,254  0
cym19_i0801,787  0
rsv_1ip01,599,042  0
rsv_2ip01,415,704  0
rsv_agoi0320,843  0
m_1ip0971,868  0
m_2ip09,969  0
m_i06,091,161  0
cym19_d01,213,959  0
mock_d03,575,771  0
cym19_1ip202,831,797  0
cym19_2ip203,573,453  0
cym19_i20924,091  0
rsv_1ip202,115,109  0
rsv_2ip203,581,821  0
rsv_i201,859,587  0
m_1ip2012,601,168  0
m_2ip202,582,005  0
m_i2011,370,037  0
pvx_i017,579,102  0
HCPro_i019,992,336  0
HCPro_t2037,383,674  0
HCPromut_t033,952,553  0
Nb_miR17302,580,489  0
Nb_Leaves02,744,027  0
NNTMV8hr04,987,852  0
NNTMV2hr06,121,523  0
NNTMV0hr06,520,239  0
Nb_1Va08,569,789  0
Nb_1Vb09,824,928  0
Nb_1Ua08,346,491  0
Nb_1Ub09,678,361  0
Ngfp10_1022,286,071  0
Ngfp5_1025,811,752  0
Npg6_1027,341,182  0
Npg8_2025,013,176  0
Npg_12_1028,801,695  0