Rice RNA-seq Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTGGGTATTTCTAGCTTTCCTTTCTTCAAAAATTGCTATATGTTG
Length: 45 nucleotides
Number of hits: 5

#ChrStrandCoordinateGeneGene strandGene startGene stopGene function 5' frag start5' fragment5' frag end3' frag start3' fragment
14c9,137,295Link to IGR (77 bp) No splicing was detected at this site

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinateGeneGene strandGene startGene stopGene function 5' frag start5' fragment5' frag end3' frag start3' fragment
28c22,325,705Link to IGR (7,715 bp)Small region at sequence (3 kb) No splicing was detected at this site
310w10,807,220Link to IGR (16,172 bp)Small region at sequence (3 kb) No splicing was detected at this site
412c11,413,085LOC_Os12g19580w11,411,96811,418,406photosynthetic reaction center protein, putative, expressed No splicing was detected at this site
513 (Cp)w26Link to IGR (38 bp) No splicing was detected at this site




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  30M
RZW0_1050,545,067  0
RZB0_1048,987,487  0
RNR0_1045,641,683  0
RZR0_1054,271,000  0
RZW24_1257,912,009  1
RZB24_104,479,134  0
RNR24_1061,573,857  0
RZR24_103,470,329  0
RZW48_1047,772,224  0
RZB48_1044,283,301  0
RNR48_1045,178,070  0
RZR48_1050,976,047  0
9LS_1057,553,952  0
NLS_1_1059,405,551  0
9NLS_1_1064,738,332  0
N9LS_2_1067,314,683  0
WT2007m035,812,905  0
WT2011m027,577,118  0
T2iZ11Rm033,931,191  0
T2iZ11Sm034,871,661  0
T4iZ11Sm028,616,989  0
T4iZ11Rm043,979,076  0
T6iZ11Rm043,706,723  0
T6P9Rm037,203,018  0
T6Sp1Rm039,841,216  0
BootPanicle502,319,519  0
BootPanicle605,639,394  0
BootPanicle704,812,192  0
BootPanicle8014,175,119  0
BootPanicle9013,230,315  0
BootPanicle10012,681,387  0
BootPanicle11015,411,338  0
BootPanicle12015,420,132  0
BootPanicle13015,206,662  0
BootPanicle14016,362,286  0
FillingPanicle10834,540  0
Flowering_leaf102,325,201  0
FlowerPanicle101,404,860  0
dcl3RNAi017,954,049  0
NPB011,556,481  0