Rice RNA-seq Signature Analysis
The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.
Sequence: TTGGGTATTTCTAGCTTTCCTTTCTTCAAAAATTGCTATATGTTG
Length: 45 nucleotides
Number of hits: 5
| # | Chr | Strand | Coordinate | Gene | Gene strand | Gene start | Gene stop | Gene function | 5' frag start | 5' fragment | 5' frag end | 3' frag start | 3' fragment | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 4 | c | 9,137,295 | Link to IGR (77 bp) | No splicing was detected at this site | |||||||||
Other perfect matches found in genome in addition to that listed above.
| # | Chr | Strand | Coordinate | Gene | Gene strand | Gene start | Gene stop | Gene function | 5' frag start | 5' fragment | 5' frag end | 3' frag start | 3' fragment | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2 | 8 | c | 22,325,705 | Link to IGR (7,715 bp) | Small region at sequence (3 kb) | No splicing was detected at this site | ||||||||
| 3 | 10 | w | 10,807,220 | Link to IGR (16,172 bp) | Small region at sequence (3 kb) | No splicing was detected at this site | ||||||||
| 4 | 12 | c | 11,413,085 | LOC_Os12g19580 | w | 11,411,968 | 11,418,406 | photosynthetic reaction center protein, putative, expressed | No splicing was detected at this site | |||||
| 5 | 13 (Cp) | w | 26 | Link to IGR (38 bp) | No splicing was detected at this site | |||||||||
SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.
| Raw Data | Normalization Denominator | |||
|---|---|---|---|---|
| Data type | Raw | Total | 30M | RZW0_1 | 0 | 50,545,067 | 0 | RZB0_1 | 0 | 48,987,487 | 0 | RNR0_1 | 0 | 45,641,683 | 0 | RZR0_1 | 0 | 54,271,000 | 0 | RZW24_1 | 2 | 57,912,009 | 1 | RZB24_1 | 0 | 4,479,134 | 0 | RNR24_1 | 0 | 61,573,857 | 0 | RZR24_1 | 0 | 3,470,329 | 0 | RZW48_1 | 0 | 47,772,224 | 0 | RZB48_1 | 0 | 44,283,301 | 0 | RNR48_1 | 0 | 45,178,070 | 0 | RZR48_1 | 0 | 50,976,047 | 0 | 9LS_1 | 0 | 57,553,952 | 0 | NLS_1_1 | 0 | 59,405,551 | 0 | 9NLS_1_1 | 0 | 64,738,332 | 0 | N9LS_2_1 | 0 | 67,314,683 | 0 | WT2007m | 0 | 35,812,905 | 0 | WT2011m | 0 | 27,577,118 | 0 | T2iZ11Rm | 0 | 33,931,191 | 0 | T2iZ11Sm | 0 | 34,871,661 | 0 | T4iZ11Sm | 0 | 28,616,989 | 0 | T4iZ11Rm | 0 | 43,979,076 | 0 | T6iZ11Rm | 0 | 43,706,723 | 0 | T6P9Rm | 0 | 37,203,018 | 0 | T6Sp1Rm | 0 | 39,841,216 | 0 | BootPanicle5 | 0 | 2,319,519 | 0 | BootPanicle6 | 0 | 5,639,394 | 0 | BootPanicle7 | 0 | 4,812,192 | 0 | BootPanicle8 | 0 | 14,175,119 | 0 | BootPanicle9 | 0 | 13,230,315 | 0 | BootPanicle10 | 0 | 12,681,387 | 0 | BootPanicle11 | 0 | 15,411,338 | 0 | BootPanicle12 | 0 | 15,420,132 | 0 | BootPanicle13 | 0 | 15,206,662 | 0 | BootPanicle14 | 0 | 16,362,286 | 0 | FillingPanicle1 | 0 | 834,540 | 0 | Flowering_leaf1 | 0 | 2,325,201 | 0 | FlowerPanicle1 | 0 | 1,404,860 | 0 | dcl3RNAi | 0 | 17,954,049 | 0 | NPB | 0 | 11,556,481 | 0 |