Soybean small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TAACTTAAATTACTTGGTCGAACC
Length: 24 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w29,387,290Phasing windowLink to IGR (55,802 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  500K1M10M
GMA0101,485,348  000
GMA0201,691,489  000
GMA0301,295,082  000
GMA0401,792,749  000
GMA05b0649,982  000
GMA06b0424,800  000
GMA07b01,814,945  000
PVU010347,891  000
PVU020292,961  000
PVU030253,683  000
PVU040151,196  000
AHY010108,792  000
AHY020187,792  000
MSDL10932,662  000
MYR10275,128  000
MINF0153,665  000
MND10176,098  000
MRG10172,898  000
MLEF0301,530  000
MRMI10135,742  000
MTR01092,570  000
8hpiW82Ps02,067,083  000
8hpiHarPs02,037,919  000
8hW82CT0783,231  000
8hHarCT0461,788  000
WT_108,045,727  000
WT_2014,781,574  000
dcl1a_1_307,146,387  000
dcl1a_1_407,698,822  000
dcl1a_2_5015,354,884  000
dcl1a_2_609,938,970  000
dcl1b_1_7120,653,962  111
dcl1b_1_8016,247,018  000
dcl1a_dcl1b_9012,172,169  000
dcl1a_dcl1b_10018,848,840  000