Brassica rapa small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AAGAACTCGTCTCTTAACTTTTAA
Length: 24 nucleotides
Number of hits: 10

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w7,039,799Phasing windowLink to IGR (8,712 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w8,719,455Phasing windowLink to IGR (2,346 bp)Small region at sequence (3 kb)
32c13,988,105Phasing windowLink to IGR (21,931 bp)Small region at sequence (3 kb)
47w10,626,409Phasing windowLink to IGR (10,981 bp)Small region at sequence (3 kb)
57c24,136,348Phasing windowLink to IGR (17,574 bp)Small region at sequence (3 kb)
68w446,256Phasing windowLink to IGR (54,304 bp)Small region at sequence (3 kb)
78c14,899,364Phasing windowLink to IGR (901 bp)Small region at sequence (3 kb)
89w34,691,903Phasing windowLink to IGR (5,997 bp)Small region at sequence (3 kb)
99w39,963,042Phasing windowLink to IGR (4,125 bp)Small region at sequence (3 kb)
1010c14,106,812Phasing windowLink to IGR (1,570 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  5M
Bn_rdr2_101,479,795  0
Bn_rdr2_201,378,684  0
Bn_wt_103,804,434  0
Bn_wt_20916,654  0
Bn_wt_302,471,459  0
SRR2136646010,031,897  0
SRR2136647011,998,088  0
SRR291289379,097,843  4
SRR2912894411,187,226  2
SRR2912891108,184,406  6