Brassica rapa small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ACTATTGGTCATACAACATTAATT
Length: 24 nucleotides
Number of hits: 27

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	26,138,222	Phasing window	Link to IGR (3,619 bp)			Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	c	4,212,771	Phasing window	BraA02g008940.3C	w	4,211,410	4,215,542	unknown function
3	2	c	6,102,236	Phasing window	Link to IGR (15,064 bp)			Small region at sequence (3 kb)
4	2	w	8,175,163	Phasing window	Link to IGR (1,435 bp)			Small region at sequence (3 kb)
5	2	w	25,296,696	Phasing window	Link to IGR (7,427 bp)			Small region at sequence (3 kb)
6	2	c	31,025,121	Phasing window	Link to IGR (5,658 bp)			Small region at sequence (3 kb)
7	3	c	4,321,959	Phasing window	Link to IGR (14,037 bp)			Small region at sequence (3 kb)
8	3	c	11,788,890	Phasing window	Link to IGR (543 bp)			Small region at sequence (3 kb)
9	3	c	28,427,414	Phasing window	Link to IGR (6,126 bp)			Small region at sequence (3 kb)
10	4	w	18,334,656	Phasing window	Link to IGR (11,786 bp)			Small region at sequence (3 kb)
11	5	c	21,159,643	Phasing window	Link to IGR (4,040 bp)			Small region at sequence (3 kb)
12	5	c	21,224,619	Phasing window	Link to IGR (2,711 bp)			Small region at sequence (3 kb)
13	6	w	8,302,530	Phasing window	Link to IGR (38,270 bp)			Small region at sequence (3 kb)
14	6	c	23,990,104	Phasing window	Link to IGR (5,316 bp)			Small region at sequence (3 kb)
15	6	w	24,726,178	Phasing window	Link to IGR (5,122 bp)			Small region at sequence (3 kb)
16	7	w	28,567,165	Phasing window	Link to IGR (1,196 bp)			Small region at sequence (3 kb)
17	8	w	4,895,481	Phasing window	Link to IGR (10,262 bp)			Small region at sequence (3 kb)
18	8	w	8,155,711	Phasing window	Link to IGR (4,405 bp)			Small region at sequence (3 kb)
19	9	w	5,380,060	Phasing window	Link to IGR (9,720 bp)			Small region at sequence (3 kb)
20	9	c	8,781,532	Phasing window	Link to IGR (7,950 bp)			Small region at sequence (3 kb)
21	9	c	8,892,446	Phasing window	Link to IGR (12,467 bp)			Small region at sequence (3 kb)
22	9	c	9,214,221	Phasing window	Link to IGR (8,042 bp)			Small region at sequence (3 kb)
23	9	c	25,213,073	Phasing window	Link to IGR (3,046 bp)			Small region at sequence (3 kb)
24	9	w	28,422,008	Phasing window	Link to IGR (21,989 bp)			Small region at sequence (3 kb)
25	9	w	33,393,559	Phasing window	Link to IGR (37,750 bp)			Small region at sequence (3 kb)
26	9	w	41,635,633	Phasing window	Link to IGR (13,713 bp)			Small region at sequence (3 kb)
27	10	c	18,142,031	Phasing window	Link to IGR (5,039 bp)			Small region at sequence (3 kb)

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	5M
Bn_rdr2_1	0	1,479,795	0
Bn_rdr2_2	0	1,378,684	0
Bn_wt_1	0	3,804,434	0
Bn_wt_2	0	916,654	0
Bn_wt_3	0	2,471,459	0
SRR2136646	0	10,031,897	0
SRR2136647	0	11,998,088	0
SRR2912893	0	9,097,843	0
SRR2912894	0	11,187,226	0
SRR2912891	4	8,184,406	2