Brassica rapa small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCAGCATCATTAAGATTCACA
Length: 21 nucleotides
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c4,903,181Phasing windowLink to IGR (7,203 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
210w13,105,548Phasing windowLink to IGR (2,933 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  5M
Bn_rdr2_101,479,795  0
Bn_rdr2_201,378,684  0
Bn_wt_103,804,434  0
Bn_wt_20916,654  0
Bn_wt_302,471,459  0
SRR213664687410,031,897  436
SRR213664777311,998,088  322
SRR29128931889,097,843  103
SRR2912894911,187,226  4
SRR29128912868,184,406  175