Brassica rapa small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: GCGTATGAGGAGCCATGCATA
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c3,412,778Phasing windowLink to IGR (13,339 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  5M
Bn_rdr2_101,479,795  0
Bn_rdr2_231,378,684  11
Bn_wt_133,804,434  4
Bn_wt_20916,654  0
Bn_wt_3102,471,459  20
SRR21366464,18610,031,897  2,086
SRR21366475,05111,998,088  2,105
SRR2912893269,097,843  14
SRR2912894811,187,226  4
SRR2912891538,184,406  32