Brassica rapa small RNA Signature Analysis
The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.
Sequence: GGGTCGACATGAGAACACATG
Length: 21 nucleotides
Number of hits: 1
| # | Chr | Strand | Coordinate | Phasing Analysis | Gene | Gene strand | Gene start | Gene stop | Gene function |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 3 | w | 2,784,134 | Phasing window | Link to IGR (2,132 bp) | Small region at sequence (3 kb) | |||
SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.
| Raw Data | Normalization Denominator | |||
|---|---|---|---|---|
| Data type | Raw | Total | 5M | Bn_rdr2_1 | 40 | 1,479,795 | 135 | Bn_rdr2_2 | 269 | 1,378,684 | 976 | Bn_wt_1 | 188 | 3,804,434 | 247 | Bn_wt_2 | 19 | 916,654 | 104 | Bn_wt_3 | 243 | 2,471,459 | 492 | SRR2136646 | 98 | 10,031,897 | 49 | SRR2136647 | 79 | 11,998,088 | 33 | SRR2912893 | 848 | 9,097,843 | 466 | SRR2912894 | 5,650 | 11,187,226 | 2,525 | SRR2912891 | 833 | 8,184,406 | 509 |