Brassica rapa small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGAAGCTGCCAGCATGATCTA
Length: 21 nucleotides
Number of hits: 3

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c21,199,411Phasing windowLink to IGR (15,744 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23w20,198,638Phasing windowLink to IGR (16,983 bp)Small region at sequence (3 kb)
35c18,181,462Phasing windowLink to IGR (9,820 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  5M
Bn_rdr2_14081,479,795  1,379
Bn_rdr2_24011,378,684  1,454
Bn_wt_16073,804,434  798
Bn_wt_2101916,654  551
Bn_wt_33842,471,459  777
SRR2136646309,73510,031,897  154,375
SRR2136647564,79311,998,088  235,368
SRR29128931,8919,097,843  1,039
SRR2912894148,49911,187,226  66,370
SRR291289118,4268,184,406  11,257