Brassica rapa small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGATTGAGCCGCGCCAATATC
Length: 21 nucleotides
Number of hits: 6

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	c	12,539,195	Phasing window	Link to IGR (4,445 bp)			Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	w	11,325,068	Phasing window	BraA03g023600.3C	c	11,324,086	11,325,903	unknown function
3	3	w	23,043,442	Phasing window	Link to IGR (2,495 bp)			Small region at sequence (3 kb)
4	4	c	1,046,939	Phasing window	BraA04g001630.3C	w	1,046,260	1,047,912	unknown function
5	7	c	18,511,281	Phasing window	BraA07g023180.3C	w	18,510,488	18,512,302	unknown function
6	9	c	468,980	Phasing window	BraA09g000760.3C	w	468,580	469,992	unknown function

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	5M
Bn_rdr2_1	17	1,479,795	57
Bn_rdr2_2	24	1,378,684	87
Bn_wt_1	44	3,804,434	58
Bn_wt_2	4	916,654	22
Bn_wt_3	25	2,471,459	51
SRR2136646	1,145	10,031,897	571
SRR2136647	1,499	11,998,088	625
SRR2912893	29	9,097,843	16
SRR2912894	926	11,187,226	414
SRR2912891	38	8,184,406	23